View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9050_low_18 (Length: 240)
Name: NF9050_low_18
Description: NF9050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9050_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 83 - 221
Target Start/End: Complemental strand, 22617706 - 22617568
Alignment:
| Q |
83 |
taatccagtttagttgaagataaatcactatgttagatcttaatctaaacgattcaaactcaactggttcaactcagaatcagaaccataactcgccgat |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22617706 |
taatccagtttagttgaagataaatcactatgttagatcttaatctaaacgattcaaactcaactgattcaactcagaatcagaaccataactcgccgat |
22617607 |
T |
|
| Q |
183 |
gatttcaaagaactttccgcaaacagtggatgaatcagg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22617606 |
gatttcaaagaactttccgcaaacagtggatgaatcagg |
22617568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 5 - 68
Target Start/End: Complemental strand, 22617796 - 22617733
Alignment:
| Q |
5 |
aaaatcgtcatcatcgccggcgacggttgaaggttagttacacttgtttaaactcaaatttaac |
68 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22617796 |
aaaatcatcatcatcgccggcgacggttgaaagttagttacacttgtttaaactcaaatttaac |
22617733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University