View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9052_low_16 (Length: 273)
Name: NF9052_low_16
Description: NF9052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9052_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 11 - 254
Target Start/End: Original strand, 29519588 - 29519839
Alignment:
| Q |
11 |
aacctgtgataattgcagtgaggttgcttgcatcaattccttgagtaacttgttcagctgttgtagaggatccaaatccacttggtccagccatgcccgt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29519588 |
aacctgtgataattgcagtgaggttgcttgcatcaattccttgagtaacttgttcagctgttgtagaggatccaaatccacttggtccagccatgcccgt |
29519687 |
T |
|
| Q |
111 |
aaccaacgagaaaatacccaccattttgattctgaagagaacaatcaaataaatctctcttgattgaaagctctaagttattataaattattttttcctt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
29519688 |
aaccaacgagaaaatacccaccattttgattctgaagagaataatcaaataaatctctcttgattgaaagctctaagctatt----attattttttcctt |
29519783 |
T |
|
| Q |
211 |
gatgtg------------tatatatatacaaatgaagataacgtgtgggatgaata |
254 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29519784 |
gatgtgtgtatatatatatatatatatacaaatgaagataacgtgtgggatgaata |
29519839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 12 - 104
Target Start/End: Complemental strand, 40099053 - 40098961
Alignment:
| Q |
12 |
acctgtgataattgcagtgaggttgcttgcatcaattccttgagtaacttgttcagctgttgtagaggatccaaatccacttggtccagccat |
104 |
Q |
| |
|
||||||||||||||| || |||||||| |||||||||||||||||||| || || || |||| || |||||||| |||||||| |||||||| |
|
|
| T |
40099053 |
acctgtgataattgcggtaaggttgctagcatcaattccttgagtaacctgctctgcagttgaagctgatccaaacccacttggaccagccat |
40098961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University