View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9052_low_21 (Length: 232)
Name: NF9052_low_21
Description: NF9052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9052_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 8467404 - 8467191
Alignment:
| Q |
1 |
ggaaaatctcagaagatggtgataaggnnnnnnntccaagttcaaagagggaaaagaccaagaaatgagtaaacggaacaatgannnnnnn---agcgtt |
97 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| ||| || |
|
|
| T |
8467404 |
ggaaaatctcagaagatggcgataaggaaaaatatccaagttcaaagagggaaaagaccaagaaatgagtaaa--gaacaatgtttttttttttagcatt |
8467307 |
T |
|
| Q |
98 |
tgctgagtatggatcattgttagtgataacatgatgagtgggcaaggtcaatcaagtagagcaagagcgacatagcaagcccaaagaattgttgtcgggt |
197 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||||||||||| |||||||| |
|
|
| T |
8467306 |
tgcttagtatggatcattgttagtgataacatgatgagtgggcaaggtcaaccaagtagagcaagagtgacataccaagcccaaagaattgatgtcgggt |
8467207 |
T |
|
| Q |
198 |
ggcgacagggggtacg |
213 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8467206 |
ggcgacagggggtacg |
8467191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 83
Target Start/End: Original strand, 6787875 - 6787920
Alignment:
| Q |
38 |
aagttcaaagagggaaaagaccaagaaatgagtaaacggaacaatg |
83 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||| || ||||||||| |
|
|
| T |
6787875 |
aagttcaaagagggtaaagaccgagaaatgagtcaaaggaacaatg |
6787920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University