View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9053_low_24 (Length: 285)
Name: NF9053_low_24
Description: NF9053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9053_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 20 - 279
Target Start/End: Original strand, 37135362 - 37135621
Alignment:
| Q |
20 |
ttatggaaaagcattcatgaaaacaccatacaggttgaaagatagaatgtttacacgatcaaaagattacatggaaattgtggagatgaaagctagaagc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37135362 |
ttatggaaaagcattcatgaaaacaccatacaggttgaaagatagaatgtttacacgatcaaaagattacatggaaattgtggagatgaaagctagaagc |
37135461 |
T |
 |
| Q |
120 |
agccaccaaatgaagaaaactctgaatggttgggatcttatttggttcggaatcggtgcagttgtcggttccggcatttttgttctcaccggtcttgaag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37135462 |
agccaccaaatgaagaaaactctgaatggttgggatcttatttggttcggaatcggcgcagttgtcggttccggcatttttgttctcaccggtcttgaag |
37135561 |
T |
 |
| Q |
220 |
ctcgtgaggaggctggtcctgccgttgttttgtcgtatgctgtctccggtatctctgctt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37135562 |
ctcgtgaggaggctggtcctgccgttgttttgtcgtatgctgtctccggtatctctgctt |
37135621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University