View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9053_low_28 (Length: 255)
Name: NF9053_low_28
Description: NF9053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9053_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 12 - 225
Target Start/End: Complemental strand, 37135111 - 37134898
Alignment:
| Q |
12 |
ttatactaacctatgattcaactacaatattgctatgaatggtctaccannnnnnnacggtaattttagtacgtttgtaaacaaatatttggttaacttg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37135111 |
ttatactaacctatgattcaactacaatattgctatgaatggtctaccatttttttacggtaattttagtacgtttgtaaacaaatatttggttaacttg |
37135012 |
T |
 |
| Q |
112 |
ttagagaatgacaactacattgagcttgctttccaccctatgtatatgtatataacattaatctagtttctagctagcttcaaaccatcaatttaatttt |
211 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37135011 |
ttagagaatgacaactacattgaacttgctttccaccctatgtatatgtatataacattaatctagtttctagctagcttcaaaccatcaatttaatttt |
37134912 |
T |
 |
| Q |
212 |
aatctttaaatttt |
225 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
37134911 |
aatcttttaatttt |
37134898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 218 - 255
Target Start/End: Complemental strand, 37134885 - 37134847
Alignment:
| Q |
218 |
taaattttaaaagga-ttttccttaaattatgtctcacc |
255 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37134885 |
taaattttaaaaggaattttccttaaattatgtctcacc |
37134847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University