View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9053_low_31 (Length: 239)
Name: NF9053_low_31
Description: NF9053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9053_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 37134864 - 37134642
Alignment:
| Q |
1 |
cttaaattatgtctcaccacctctttgatttgtggcagaaaactattttattggacaattcattttcgctacaaaatttatctagataaatagcattgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37134864 |
cttaaattatgtctcaccacctctttgatttgtggcagaaaactattttattggacaattcattttcgctacaaaatttatctagataaatagcattgct |
37134765 |
T |
|
| Q |
101 |
cattttaaaactgcaataacttaaattttttcaattcatttatttacagtgtcaatattttttgagatattgtaattgtgaacaagatcataaaaaggct |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37134764 |
cattttaaaactgtaataacttaaattttttcaattcatttacttacagtgtcaatattttttgagatattgtaattgtgaacaagatcataaaaaggct |
37134665 |
T |
|
| Q |
201 |
ttagacacaaatcatatatttat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37134664 |
ttagacacaaatcatatatttat |
37134642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 11207247 - 11207318
Alignment:
| Q |
1 |
cttaaattatgtctcaccacctctttgatttgtgg-cagaaaactattttattggacaattcattttcgcta |
71 |
Q |
| |
|
||||||||||| | ||||||| | ||||||||||| ||| |||| ||||||||||||| || |||||||||| |
|
|
| T |
11207247 |
cttaaattatgccccaccacccccttgatttgtggccaggaaacaattttattggacacttaattttcgcta |
11207318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University