View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9054_low_7 (Length: 368)
Name: NF9054_low_7
Description: NF9054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9054_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 278; Significance: 1e-155; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 16 - 352
Target Start/End: Complemental strand, 45131032 - 45130698
Alignment:
| Q |
16 |
accataactccaacatctttgtctttacactcaaacagaatttctgcaaaattaacaaattttatatatcactgtcctgttcatacaatcaacatggtaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||| ||||||||| |
|
|
| T |
45131032 |
accataactccaacatctttgtctttacactcaaacagaatttctgcaaaattaacaaattttatatatcattgtcccgttgatacaatcgacatggtaa |
45130933 |
T |
 |
| Q |
116 |
aagatattagtctctgcagctgcgtatggaggatacccaatttacacacaacaatnnnnnnnnnnctcaataatatatataaaattaccccgcctcactt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45130932 |
aagatattagtctctgcagctgcgtatggaggatacccaatttacacacaacaataaaaaaaa--ctcaataatatatataaaattaccccgcctcactt |
45130835 |
T |
 |
| Q |
216 |
acttttgagatcaggtcttgcaccaaaatgtacattggtagcttgcaccaaagattgatgaggaaggctttcaagctctctttctgaaccataaatccat |
315 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45130834 |
actcttgagatcaggtcttgcaccaaaatgtacattggtagcttgcagcaaagattgatgaggaaggctttcaagctctctttctgaaccataaatccat |
45130735 |
T |
 |
| Q |
316 |
gaccctggtgatcttgttggtgttggaacttctacat |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45130734 |
gaccctggtgatcttgttggtgttggaacttctacat |
45130698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 196 - 352
Target Start/End: Complemental strand, 45113950 - 45113794
Alignment:
| Q |
196 |
aaaattaccccgcctcacttacttttgagatcaggtcttgcaccaaaatgtacattggtagcttgcaccaaagattgatgaggaaggctttcaagctctc |
295 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
45113950 |
aaaattaccctgcctcacttactcttgagatcaggtcttgagccaaaatgtacattggtagcttgcactaaagattgatgaggaaggctctcaagctctc |
45113851 |
T |
 |
| Q |
296 |
tttctgaaccataaatccatgaccctggtgatcttgttggtgttggaacttctacat |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
45113850 |
tttctgaaccataaatccatgaccctggtgatcttgctggtgttgaaacttctacat |
45113794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 76
Target Start/End: Complemental strand, 45114129 - 45114071
Alignment:
| Q |
18 |
cataactccaacatctttgtctttacactcaaacagaatttctgcaaaattaacaaatt |
76 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45114129 |
cataactccaacatctttgccttcacactcaaacagaatttctgcaaaattaacaaatt |
45114071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 212 - 259
Target Start/End: Complemental strand, 11593427 - 11593380
Alignment:
| Q |
212 |
acttacttttgagatcaggtcttgcaccaaaatgtacattggtagctt |
259 |
Q |
| |
|
|||||||||| |||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
11593427 |
acttacttttaagatcaggtctttcaccataatgcacattggtagctt |
11593380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University