View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9055_high_13 (Length: 415)
Name: NF9055_high_13
Description: NF9055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9055_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 107 - 374
Target Start/End: Original strand, 15131088 - 15131353
Alignment:
| Q |
107 |
gttcattgcagaaaatgttcaagaacacattccagtctggatttctttccatattatacagcctcgggtaatgatgtggttggcttgtttatttcatatt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15131088 |
gttcattgcagaaaatgttcaagaacacattccagtctggatttctttccatattatacagcctcgggtaatgatgtggttggcttgtttatttcatatt |
15131187 |
T |
 |
| Q |
207 |
tcagtttcatatgtttgttgtgattattaaggtgctgaaattttgcattttgttttcaa-nnnnnnnnattattgtaggagcaaacctttgcagatatgg |
305 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15131188 |
tcagtttcatatgtttgttgtg---attaaggtgctgaaattttgcattttgttttcaatttttttttattattgtaggagcaaacctttgcagatatgg |
15131284 |
T |
 |
| Q |
306 |
gacaaagaaggtaattgnnnnnnngtttgcaatgacattagatagtaatttttctgcttgctagaaatt |
374 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15131285 |
gacaaagaaggtaattgtttttttgtttgcaatgacattagatagtaatttttctgcttgctagaaatt |
15131353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 55 - 109
Target Start/End: Original strand, 15130904 - 15130958
Alignment:
| Q |
55 |
tttagatgtactatatgatggataatagtgaaagtttcattaatgaattatggtt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15130904 |
tttagatgtactatatgatggataatagtgaaagtttcattaatgaattatggtt |
15130958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 371 - 403
Target Start/End: Original strand, 15131364 - 15131396
Alignment:
| Q |
371 |
aattgaattgatccgaaatcattttactttgat |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
15131364 |
aattgaattgatccgaaatcattttactttgat |
15131396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 23 - 54
Target Start/End: Original strand, 15129990 - 15130021
Alignment:
| Q |
23 |
gaattgcactaaaccctaattttgaattagag |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
15129990 |
gaattgcactaaaccctaattttgaattagag |
15130021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University