View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9055_high_25 (Length: 263)
Name: NF9055_high_25
Description: NF9055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9055_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 15 - 244
Target Start/End: Original strand, 40025767 - 40025996
Alignment:
| Q |
15 |
ttattctcaacttgattaacttctattgtgtcacttgattcattgggtgaagacacattaagactattatcaagagattcaaaatctgtttcagaaccat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40025767 |
ttattctcaacttgattaacttctattgtgtcacttgattcattgggtgaagacacattaagactattatcaagagattcaaaatctgtttcagaagcat |
40025866 |
T |
 |
| Q |
115 |
cttctgtctgtttcaccaccttgcatgactcaacatgttcatcaatatcaacaacatcttcggtatcaccgataaacttggattttccatcacaatcatc |
214 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40025867 |
cttctgtctgttccaccaccttgcatgactcaacatgttcatcaatatcaacaacatcttcggtatcaccgataaacttggcttttccatcacaatcatc |
40025966 |
T |
 |
| Q |
215 |
atcagcagatacttcaacagctaccccctt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40025967 |
atcagcagatacttcaacagctaccccctt |
40025996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University