View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9056_high_15 (Length: 302)
Name: NF9056_high_15
Description: NF9056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9056_high_15 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 302
Target Start/End: Original strand, 48835729 - 48836030
Alignment:
| Q |
1 |
ttctcgcgcctttgcctctctgcctccacatgatttagaggttcgtcccttccattagcaggcttccttccgcgcttcctaggtctcctttcatcactag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48835729 |
ttctcgcgcctttgcctctctgcctccacatggtttagaggttcgtcccttccattagcaggcttccttccgcgcttcctaggtctcctttcatcactag |
48835828 |
T |
 |
| Q |
101 |
gttgatcagcctcaacatcagcaacaagttccgattcagcaataaccggtctcacagaattagccctcgaatttgctcccgaaaagtcaatttgcattgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48835829 |
gttgatcagcctcaacatcagcaacaagttccgattcagcaataaccggtctcacagaattagcccttgaatttgctcccgaaaagtcaatttgcattgg |
48835928 |
T |
 |
| Q |
201 |
catctgcctttgtggttggtagttgctattattgttgttgagcctaaaatcctttctaacaccattagaagcaaaaatttcaccttgaccttgattcact |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48835929 |
catctgcctttgtggttggtagttgctattattgttgttgagcctaaaatcctttctaacaccattagaagcaaaaatttcaccttgaccttgattcact |
48836028 |
T |
 |
| Q |
301 |
cc |
302 |
Q |
| |
|
|| |
|
|
| T |
48836029 |
cc |
48836030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 9804696 - 9804602
Alignment:
| Q |
1 |
ttctcgcgcctttgcctctctgcctccacatgatttagaggttcgtcccttccattagcaggcttccttccgcgcttcctaggtctcctttcatc |
95 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| || ||||| |||||||||| || ||||| || || || ||||| || ||||| ||||| |
|
|
| T |
9804696 |
ttctcgcgtctttgcctctctgcctccacatgattgaggggttctacccttccatttgctggctttctgccacgtttccttggcctcctatcatc |
9804602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University