View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9056_high_19 (Length: 242)
Name: NF9056_high_19
Description: NF9056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9056_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 5 - 224
Target Start/End: Complemental strand, 13179361 - 13179145
Alignment:
| Q |
5 |
ttttgacctcttgatagagttgaataagtggtttttgatgttgaattcttttactttctctgtttcgtgcccaacttggcagtcacaaacaaatatatgg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
13179361 |
ttttgacctcttgatagagttgaataagtggtttttgatgttgaattcttttactttctctgtttcgtgcccaacttggcagtcacaaacaaatatat-g |
13179263 |
T |
 |
| Q |
105 |
ggaaaatatgtaatttcacagacatgtaaataagtgtattcagtcacacatgtgacttgcaatgagatatcccttgtaagaattttagtcaattgtgtca |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13179262 |
ggaaaatatgtaattt--cagacatgtaaataagtgtattcagtcccacatgtgacttgcaatgagatatcccttgtaagaattttagtcaattgtgtca |
13179165 |
T |
 |
| Q |
205 |
ggagaactaatacaaggact |
224 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
13179164 |
ggagaactaatacaaggact |
13179145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University