View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9056_low_50 (Length: 225)
Name: NF9056_low_50
Description: NF9056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9056_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 31443558 - 31443764
Alignment:
| Q |
1 |
tagtggacgcgtggtgttgacgtcgaggaagagagcgaatgtaagacgaatggcgtcgtagtatacacctttgtcttcgttttggtttgcgagtttgagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31443558 |
tagtggacgcgtggtgttgacgtcgaggaagagagcgaatgtaagacaaatggcgtcgtagtatacacctttgtcttcgttttggtttgcgagtttgagg |
31443657 |
T |
|
| Q |
101 |
ttgaagatgatagtgttgttgatggagtgtttgtgattggaagtgatagttttgttgagagaaggaaggtagagtgactgaatgaagcattttggttgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31443658 |
ttgaagatgatagtgttgttgatggagtgtttgtgattggaagtgatagttttgttgagagaaggaaggtagagtgattgaatgaagcattttggttgtt |
31443757 |
T |
|
| Q |
201 |
gagttct |
207 |
Q |
| |
|
||||||| |
|
|
| T |
31443758 |
gagttct |
31443764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University