View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9056_low_52 (Length: 218)
Name: NF9056_low_52
Description: NF9056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9056_low_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 15 - 202
Target Start/End: Original strand, 55174733 - 55174920
Alignment:
| Q |
15 |
cagagattttcagataaaattaattgcttagtcctcaatggtagaacatcaatcctgtgctaccttggtcaatgcctctacattttgtgatatagaacaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55174733 |
cagagattttcagataaaattaattgcttagtcctcaatggtagaacatcaatcctgtgctaccttggtcaatgcctctacattttgtgatatagaacaa |
55174832 |
T |
|
| Q |
115 |
gaagtgaatggagataatgtcaacaatgttgctcagatttcagccgagttggaaagggaaaggaagaagaatgcggagctcatggaaa |
202 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55174833 |
gaagtgaatggagataatgtcaacgatgtttctcagatttcagccgagttggaaagggaaaggaagaagaatgcggagctcatggaaa |
55174920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 97 - 202
Target Start/End: Original strand, 50906734 - 50906840
Alignment:
| Q |
97 |
ttttgtgatatagaacaagaagtgaatggagataat-gtcaacaatgttgctcagatttcagccgagttggaaagggaaaggaagaagaatgcggagctc |
195 |
Q |
| |
|
|||||||| |||||| |||||| ||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| ||||||||| |||| || |
|
|
| T |
50906734 |
ttttgtgacatagaataagaagcgaatggagataattgtcaacgttgttgctcgtatttcagccgagttggaaagggaaaggcagaagaatgtggagatc |
50906833 |
T |
|
| Q |
196 |
atggaaa |
202 |
Q |
| |
|
||||||| |
|
|
| T |
50906834 |
atggaaa |
50906840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 42 - 98
Target Start/End: Original strand, 50952792 - 50952849
Alignment:
| Q |
42 |
ttagtcctcaatggtagaacatcaatcctgtgctacc-ttggtcaatgcctctacatt |
98 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |||| |
|
|
| T |
50952792 |
ttagtcctcaatggtagaacatcaatcatgtgctacctttggtcaatgcctctgcatt |
50952849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 141 - 202
Target Start/End: Original strand, 55178544 - 55178605
Alignment:
| Q |
141 |
tgttgctcagatttcagccgagttggaaagggaaaggaagaagaatgcggagctcatggaaa |
202 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
55178544 |
tgttgctgagatttcattggagttggaaagggaaaggctgaaaaatgcggagctcatggaaa |
55178605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University