View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9059_low_39 (Length: 248)
Name: NF9059_low_39
Description: NF9059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9059_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 75 - 233
Target Start/End: Complemental strand, 7237052 - 7236894
Alignment:
| Q |
75 |
acttatatcaactaaaattgattaaaaacgtgtgattttttccactttattgtatatatttggtacttcgggtttgagacggaagaatgatgatttttac |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7237052 |
acttatatcaactaaaattgattaaaaacgtgtgattttttccactttattgtatatatttggtacttcgggtttgagacggaagaatgatgatttttac |
7236953 |
T |
 |
| Q |
175 |
atctttttcttgttttcgaaggtaaatgattgatagaacattagaagaaagaaacaaag |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7236952 |
atctttttcttgttttcgaaggtaaatgattgatagaaccttagaagaaagaaacaaag |
7236894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 7237346 - 7237285
Alignment:
| Q |
1 |
ttcatgcagaatttgtatcaactaaactcaatttgttatggaaaattgaatatgagataact |
62 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7237346 |
ttcatgcagaatttgtattaaataaactcaatttgttatggaaaattgaatatgagataact |
7237285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University