View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9059_low_7 (Length: 665)
Name: NF9059_low_7
Description: NF9059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9059_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 5e-36; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 322 - 451
Target Start/End: Complemental strand, 2480375 - 2480253
Alignment:
| Q |
322 |
ttgtagcacatatttatcagtgagaaattgaacactgcaagataaagaattgcataatttgtacacaaaa-taagattcagtttgaaatcaagtgagaat |
420 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
2480375 |
ttgtagcacatatttatcagcgagaaattgaacactgcaa--------attgcataatttggacacaaaaataagattcagtttgaaatcaggtgagaat |
2480284 |
T |
|
| Q |
421 |
acacatttgttaggtacatactaggtgaaaa |
451 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |
|
|
| T |
2480283 |
acacatttgttaggaacatactaggtgaaaa |
2480253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 585 - 647
Target Start/End: Complemental strand, 2480075 - 2480013
Alignment:
| Q |
585 |
caatttattgttgaagaaaggatacaaagtgttcatacctttctttagaaataccaatgtgag |
647 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2480075 |
caatttattgttgaagaaaggatacaaagtgttcatacctttctttagaaataccaatgtgag |
2480013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 545 - 584
Target Start/End: Complemental strand, 2480177 - 2480138
Alignment:
| Q |
545 |
ccaaaaagtaaaattaacatgtaagtagcatgagataaca |
584 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2480177 |
ccaaaaagtaaaattaacatgtaaatagcatgagataaca |
2480138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University