View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9060_low_46 (Length: 250)
Name: NF9060_low_46
Description: NF9060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9060_low_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 5 - 234
Target Start/End: Complemental strand, 8047179 - 8046950
Alignment:
| Q |
5 |
tcaaaataattaacacggaaaaatacctacatatttatcactctaggtagtctagctagcatgaaacagaaaacggtgctattctttccattttgaatgc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8047179 |
tcaaaataattaacacggaaaaatacctacatatttatcactctaggtagtctagctagcatgaaacaaaaaacggtgctattctttccattttgaatgc |
8047080 |
T |
|
| Q |
105 |
atttcttctctccctaaagtttatagctagctattcaattttagataaaaatctcaaacaattaacttttttcaaaagcaatcattataatagcttagcc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8047079 |
atttcttctctccctaaagtttatagctagctattcaattttagataaaaatctcaaacaattaacttttttcaaaagcaatcattataatagcttagcc |
8046980 |
T |
|
| Q |
205 |
acacttcaacactccattattacttgttta |
234 |
Q |
| |
|
||||||||||| |||||||||||||||||| |
|
|
| T |
8046979 |
acacttcaacaatccattattacttgttta |
8046950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University