View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9060_low_48 (Length: 246)
Name: NF9060_low_48
Description: NF9060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9060_low_48 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 20 - 246
Target Start/End: Complemental strand, 32515648 - 32515422
Alignment:
| Q |
20 |
agtctcgagtatagttctttgatctttaactttatcaagccatcaaaagagtaatctacctgaaattggcaaacatgagctccgtctccgtatacttttc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32515648 |
agtctcgagtatagttctttgatctttaactttatcaagccataaaaagagtaatctacctgaaattggcaaacatgagctccgtctccgtatacttttc |
32515549 |
T |
|
| Q |
120 |
ttatagtttcaacagttttatctgttggagatcttggaaagtaaggaacacctagagcaacaaaccccttcactctatcaggcctaaatagacttaggtg |
219 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32515548 |
ttatagtttcaacagttttatcagttggagatcttggaaagtaaggaacacctagagcaacaaaccccttcactctatcaggcctaaatagacttaggtg |
32515449 |
T |
|
| Q |
220 |
ccatccaatgtttgcacccaagtcaga |
246 |
Q |
| |
|
||||||||||||||||||| ||||||| |
|
|
| T |
32515448 |
ccatccaatgtttgcaccccagtcaga |
32515422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University