View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9060_low_49 (Length: 243)
Name: NF9060_low_49
Description: NF9060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9060_low_49 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 63 - 187
Target Start/End: Complemental strand, 36240413 - 36240289
Alignment:
| Q |
63 |
gcatatcataccccgttgaaggctagtattcttgttcttttgatcccttcatagctagttaactagttgatgtaattgttttttcttcttctgttctcaa |
162 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36240413 |
gcatatcatatccccttgaaggctagtattcttgttctttcgatcccttcatagctagttaactagttgatgtaattgttttttcttcttctgttctcaa |
36240314 |
T |
|
| Q |
163 |
ggttccaaagttccatggttttcag |
187 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
36240313 |
ggttccaaagttccatggttttcag |
36240289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University