View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9061_high_28 (Length: 225)
Name: NF9061_high_28
Description: NF9061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9061_high_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 209
Target Start/End: Complemental strand, 9870794 - 9870599
Alignment:
| Q |
14 |
attatactttttaatgaaaacagaaaatatttgctacaagagtgtacgtcttttaaggtgctatggataatggttgtgtgactactgtctactgaaaaca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9870794 |
attatactttttaatgaaaacagaaaatatttgctacaagagtgtacgtcttttaaggtgctgtggataatggttgtgtgactactgtctactgaaaaca |
9870695 |
T |
|
| Q |
114 |
atatctaatgaaaaacattcctcttggcattgttggatctcatataaatcaactaatgccagaaaacaatgttaagagtcaggcatgattggtttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9870694 |
atatctaatgaaaaacattcctcttggcattgttggatctcatataaatcaactaatgccagaaaacaatgttaagagtcaggcataattggtttt |
9870599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 97
Target Start/End: Complemental strand, 9896002 - 9895933
Alignment:
| Q |
29 |
gaaaacagaaaatatttgctacaagagtgtacgtct-tttaaggtgctatggataatggttgtgtgacta |
97 |
Q |
| |
|
||||||||||||||||||| ||||||| || |||| |||||||| || |||||||||| |||||||||| |
|
|
| T |
9896002 |
gaaaacagaaaatatttgccacaagagcttaagtctctttaaggttctgtggataatggctgtgtgacta |
9895933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University