View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9061_low_53 (Length: 301)
Name: NF9061_low_53
Description: NF9061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9061_low_53 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 17 - 289
Target Start/End: Original strand, 1905563 - 1905835
Alignment:
| Q |
17 |
aggtactagatggctcattcccccaatcaaaggattaaggatagctaaaacgcaagtaaattaatgcttgttcccggaccaatattttactacaagaatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1905563 |
aggtactagatggctcattcccccaatcaaaggattaaggatagctaaaacgcaagtaaattaatgcttgttcccggaccaatattttactacaagaatt |
1905662 |
T |
|
| Q |
117 |
ctggaaatacatgcagtacattatgatttatgcttaatttgtcttctgtgaagcatacttgaaccaaattatccatgagggttggtggttcaccgtggga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1905663 |
ctggaaatacatgcagtacattatgatttatgcttaatttgtcttctgtgaagcatacttgaaccaaattatccatgagggttggtggttcaccgtggga |
1905762 |
T |
|
| Q |
217 |
aagggaggaaagatcaggtgatgaaagtcgttcagctcgaagtgtgtatgtcgatacaccacggccacaggtt |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
1905763 |
aagggaggaaagatcaggtgatgaaagtcgttcagctcgaagtgtgtatgtcgatgcaccacggccacgggtt |
1905835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University