View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9061_low_58 (Length: 269)
Name: NF9061_low_58
Description: NF9061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9061_low_58 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 258
Target Start/End: Complemental strand, 26347823 - 26347579
Alignment:
| Q |
14 |
gacatcaggcatactcaagggatcaacttacaaactagtcatagaatgaggtttcttgacactaacaggtgaaacaacatttttaggttttctagtaagt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26347823 |
gacatcaggcatactcaagggatcaacttacaaactagtcatagaatgaggtctcttaacactaacaggtgaaacaacatttttatgttttctagtaagc |
26347724 |
T |
|
| Q |
114 |
aactaaacagacacagagtgatgagagggttcacttacatgtgaaggattagcctttttcgcagtagttgtattggtcattttcttggtgggaacacgac |
213 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
26347723 |
aactaaacagacacaaagtgatgagagggttcacttacatgtgaaggattagccttttttgcagtagttgtattggtcattttcttggtgggaacatgac |
26347624 |
T |
|
| Q |
214 |
ctggaacagccctaataggaacaatatcggtcacaacttatgatg |
258 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26347623 |
ctggaacaaccctaataggaacaatatcggtcataacttatgatg |
26347579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University