View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9061_low_69 (Length: 249)
Name: NF9061_low_69
Description: NF9061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9061_low_69 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 4 - 249
Target Start/End: Original strand, 38339607 - 38339852
Alignment:
| Q |
4 |
ggagcacagatcatcctggaattgatttcacggtaagatcataatcattaggccnnnnnnnnnnnnnnnnnnnnnngataaaccattgcaaagacaaatg |
103 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
38339607 |
ggagctcagatcatcctggaattgatttcacggtaagatcataatcattaggccttattatttttatttttattttgataaactattgcaaagacaaatg |
38339706 |
T |
 |
| Q |
104 |
ttggagatacaagtgattttggtcagacctcaatgaacaggactggaccattggagcctacttatctctcttttgctccggcccaatggttcaatcttgt |
203 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38339707 |
ttggagatacaagtgattagggtcagacctcaatgaacaagactggaccactggagcctccttatctcttatttgctccggcccaatggttcaatcttgt |
38339806 |
T |
 |
| Q |
204 |
tctctgatgtctgatccgtatcacttatatctctaacgtttgtctg |
249 |
Q |
| |
|
||||||||| || ||||| ||||||||||||||||||||||||||| |
|
|
| T |
38339807 |
tctctgatgcctaatccgaatcacttatatctctaacgtttgtctg |
38339852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University