View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9061_low_76 (Length: 223)
Name: NF9061_low_76
Description: NF9061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9061_low_76 |
 | |
|
| [»] scaffold0372 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 3 - 196
Target Start/End: Complemental strand, 21447334 - 21447141
Alignment:
| Q |
3 |
gctcttgtgctactgagcatccaagtccaaaacaaatggctattgaaggatataaggcgcagagtgagatggtgattgacagtcttgataggctaatcac |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21447334 |
gctcttgtgctactgagcatccaagtccaaaacaaatggctattgaaggatataaggcgcagagtgagatggtgattgacagtcttgataggctaatcac |
21447235 |
T |
|
| Q |
103 |
tgcctgggaagaacgaaaacagtctgttgttgtcgagggagttcacttgagtctcaactttgttgtatgtcaaaacttgattacatgtccatta |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21447234 |
tgcctgggaagaacgaaaacagtctgttgttgtcgagggagttcacttgagtctcaactttgttgtatgtcaaaacttgattacatgtccatta |
21447141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0372 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: scaffold0372
Description:
Target: scaffold0372; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 3 - 169
Target Start/End: Original strand, 4202 - 4368
Alignment:
| Q |
3 |
gctcttgtgctactgagcatccaagtccaaaacaaatggctattgaaggatataaggcgcagagtgagatggtgattgacagtcttgataggctaatcac |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4202 |
gctcttgtgctactgagcatccaagtccaaaacaaatggctattgaaggatataaggcgcagagtgagatggtgattgacagtcttgataggctaatcac |
4301 |
T |
|
| Q |
103 |
tgcctgggaagaacgaaaacagtctgttgttgtcgagggagttcacttgagtctcaactttgttgta |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4302 |
tgcctgggaagaacgaaaacagtctgttgttgtcgagggagttcacttgagtctcaactttgttgta |
4368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 30 - 173
Target Start/End: Original strand, 40685310 - 40685453
Alignment:
| Q |
30 |
caaaacaaatggctattgaaggatataaggcgcagagtgagatggtgattgacagtcttgataggctaatcactgcctgggaagaacgaaaacagtctgt |
129 |
Q |
| |
|
|||||||||||||| ||||||||| ||||| |||||||| |||||||||||||| || ||||||||||||||| | ||||||||||| ||| |||| || |
|
|
| T |
40685310 |
caaaacaaatggctgttgaaggattcaaggcccagagtgaaatggtgattgacagcctagataggctaatcacttcatgggaagaacggaaagagtccgt |
40685409 |
T |
|
| Q |
130 |
tgttgtcgagggagttcacttgagtctcaactttgttgtatgtc |
173 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40685410 |
tgttgttgagggtgttcacttgagtctcaactttgttgtatgtc |
40685453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University