View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9063_high_11 (Length: 257)
Name: NF9063_high_11
Description: NF9063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9063_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 29 - 255
Target Start/End: Complemental strand, 28255157 - 28254931
Alignment:
| Q |
29 |
agagaaaatcacttgagtatatgagtacctaactttcaaatgaacaagtcgaactgcaatgctctttacactgtcacattatatgtatgttggtgcaact |
128 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28255157 |
agagaaaatcacttgagtat--gagtacctaactttcaaatgaacaagtcgaactgcaatgctctttacactgtcacattatatgtatgttggtgcaact |
28255060 |
T |
 |
| Q |
129 |
gcaggctaaccacttgcagaatggtcttgcttttttatatcaaag--gaaaaataattatggtcttacttttaacacttttcttcaatattctttgtctt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28255059 |
gcaggctaaccacttgcagaatggtcttgcttttttatatcaaagaaaaaaaataattatggtcttgcttttaacacttttcttcaatattctttgtctt |
28254960 |
T |
 |
| Q |
227 |
cccctgnnnnnnncctaacttcttgatgt |
255 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
28254959 |
cccctgtttttttcctaacttcttgatgt |
28254931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University