View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9063_high_12 (Length: 253)
Name: NF9063_high_12
Description: NF9063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9063_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 19 - 173
Target Start/End: Original strand, 31944749 - 31944903
Alignment:
| Q |
19 |
accttggagtttggttggataacggcggtatggtccttgtaggtagcatttccatatggtgaacactctgatacctcagagtttgtgtgccccaagacac |
118 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
31944749 |
accttggagtttggttggataccggcggtatggtccttgtaggtagcatttccatatggtgaacactctgttacctcagagtttgtgtgccccgagacac |
31944848 |
T |
 |
| Q |
119 |
tagttaagaaaaccaacatagaatgattgtattggaaattgtggaaatatgagta |
173 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31944849 |
tagttaagaaaaccaacataaaatgattgtattggaaattgtggaaatatgagta |
31944903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 113 - 165
Target Start/End: Complemental strand, 31776098 - 31776046
Alignment:
| Q |
113 |
agacactagttaagaaaaccaacatagaatgattgtattggaaattgtggaaa |
165 |
Q |
| |
|
||||||||||||||||||| || |||||| |||||||||| ||||||| |||| |
|
|
| T |
31776098 |
agacactagttaagaaaactaatatagaaagattgtattgaaaattgtagaaa |
31776046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University