View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9063_low_24 (Length: 257)

Name: NF9063_low_24
Description: NF9063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9063_low_24
NF9063_low_24
[»] chr7 (1 HSPs)
chr7 (29-255)||(28254931-28255157)


Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 29 - 255
Target Start/End: Complemental strand, 28255157 - 28254931
Alignment:
29 agagaaaatcacttgagtatatgagtacctaactttcaaatgaacaagtcgaactgcaatgctctttacactgtcacattatatgtatgttggtgcaact 128  Q
    ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28255157 agagaaaatcacttgagtat--gagtacctaactttcaaatgaacaagtcgaactgcaatgctctttacactgtcacattatatgtatgttggtgcaact 28255060  T
129 gcaggctaaccacttgcagaatggtcttgcttttttatatcaaag--gaaaaataattatggtcttacttttaacacttttcttcaatattctttgtctt 226  Q
    |||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||| |||||||||||||||||||||||||||||||||    
28255059 gcaggctaaccacttgcagaatggtcttgcttttttatatcaaagaaaaaaaataattatggtcttgcttttaacacttttcttcaatattctttgtctt 28254960  T
227 cccctgnnnnnnncctaacttcttgatgt 255  Q
    ||||||       ||||||||||||||||    
28254959 cccctgtttttttcctaacttcttgatgt 28254931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University