View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9063_low_31 (Length: 244)
Name: NF9063_low_31
Description: NF9063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9063_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 4701985 - 4702212
Alignment:
| Q |
1 |
ctactagctcacgtgacatgatttggaaactggctgaaactggaatgaatgtggcccgtttgaacatgtcacacggggaccacacttcccatcagaaaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4701985 |
ctactagctcacgtgacatgatttggaaactggctgaaactggaatgaatgtggcgcgtttgaacatgtcacacggggaccacacttcccatcagaaagc |
4702084 |
T |
 |
| Q |
101 |
tattgattttgttaaacaatacaattctcagtttcaagatagagttatttccatcatgcttgacaccaaggttaaattattcattgcattgcgtaataaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702085 |
tattgattttgttaaacaatacaattctcagtttcaagatagagttatttccatcatgcttgacaccaaggttaaattattcattgcattgcgtaataaa |
4702184 |
T |
 |
| Q |
201 |
gtagagacaccgaacacaacaccaacac |
228 |
Q |
| |
|
| ||||||||||||||||||||| |||| |
|
|
| T |
4702185 |
gcagagacaccgaacacaacaccgacac |
4702212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 172
Target Start/End: Complemental strand, 44854283 - 44854129
Alignment:
| Q |
18 |
atgatttggaaactggctgaaactggaatgaatgtggcccgtttgaacatgtcacacggggaccacacttcccatcagaaaactattgattttgttaaac |
117 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||| || ||| |||| ||||| || || || || |||| ||| ||||| ||||||||| || ||| |
|
|
| T |
44854283 |
atgatttggaaacttgctgaggctggaatgaatgttgctcgtatgaatatgtctcatggtgatcatgcttctcataagaaagttattgatttggtgaaag |
44854184 |
T |
 |
| Q |
118 |
aatacaattctcagtttcaagatagagttatttccatcatgcttgacaccaaggt |
172 |
Q |
| |
|
| || ||| | || | | |||||| |||||| | |||||||||||||||||||| |
|
|
| T |
44854183 |
agtataatgcacaatctaaagataatgttattgcaatcatgcttgacaccaaggt |
44854129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University