View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9064_low_18 (Length: 329)
Name: NF9064_low_18
Description: NF9064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9064_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 161 - 322
Target Start/End: Original strand, 36129302 - 36129463
Alignment:
| Q |
161 |
aaagactaaagaatacgctctcaactttacactaactcttcaattcaattcctatgctcactgtaaattaaatgagcaaaatgatatacaagcaaagcaa |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36129302 |
aaagactaaagaatacgctctcaactttacactaactcttcaattcaattcctatgctcactgtaaattaaatgagcaaaatgatatacaagcaaagcaa |
36129401 |
T |
 |
| Q |
261 |
ctttacaaaaccctctacccttctctctatctatctatttctctgttttgtctctgcttctc |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36129402 |
ctttacaaaaccctctacccttctctctatctatctatttctctgttttgtctctgcctctc |
36129463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 24 - 134
Target Start/End: Original strand, 36129161 - 36129271
Alignment:
| Q |
24 |
ggaaggtattgtttggtgttgaaagagggaaaggtaagtgaagaggtagtgatgatgaagaagttcttggagttatgaattggtggaattggtcagggac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36129161 |
ggaaggtattgtttggtgttgaaagagggaaaggtaagtgaagaggtagtgatgatgaagaagttcttggagttatgaattggtggaattggtcagggac |
36129260 |
T |
 |
| Q |
124 |
tccatcataca |
134 |
Q |
| |
|
||||||||||| |
|
|
| T |
36129261 |
tccatcataca |
36129271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University