View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9064_low_20 (Length: 320)
Name: NF9064_low_20
Description: NF9064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9064_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 270; Significance: 1e-151; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 11 - 304
Target Start/End: Original strand, 13520534 - 13520827
Alignment:
| Q |
11 |
cacagagtggatgaaattgatgagactaaatttgtgtacaactttagcattattgggggcactggtttggctgacacattggagaaagtctcattcaaga |
110 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| | |
|
|
| T |
13520534 |
cacagagtggatgaaattgatgaaacaaaatttgtgtacaactttagcattattgggggcactggattggctgacacattggaaaaagtctcattcaaaa |
13520633 |
T |
|
| Q |
111 |
gccaattggtagaaggaccaaatggtgggtccattaggaatgtacatgttgattattttaccaaaggtgattataatctaagtgaggaggaattgaaagc |
210 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13520634 |
gccaattggtggaaggaccaaatggtgggtccattaggaatgtacatgttgattattttaccaaaggtgattataatctaagtgaggaggaattgaaagc |
13520733 |
T |
|
| Q |
211 |
tggtaaagcaaaggttgaaggacttgtaaagcttgttgaaggttaccttttggcaaatcctgattactgaatatgtttaattagggttaataag |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13520734 |
tggtaaagcaaaggttgaaggacttgtaaagcttgttgaaggttaccttttggcaaatcctgattactgaatatgtttaattagggttaataag |
13520827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 246 - 278
Target Start/End: Original strand, 13485822 - 13485854
Alignment:
| Q |
246 |
ttgaaggttaccttttggcaaatcctgattact |
278 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
13485822 |
ttgaaggttacgttttggcaaatcctgattact |
13485854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 246 - 278
Target Start/End: Original strand, 13492261 - 13492293
Alignment:
| Q |
246 |
ttgaaggttaccttttggcaaatcctgattact |
278 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
13492261 |
ttgaaggttacgttttggcaaatcctgattact |
13492293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University