View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9066_low_17 (Length: 327)
Name: NF9066_low_17
Description: NF9066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9066_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 73 - 202
Target Start/End: Complemental strand, 38928968 - 38928839
Alignment:
| Q |
73 |
ccaatcagctcaagcttcaccccatttgccaggcttcctctacacaagaaacagaggaacatgcactccacagtaataataacaaattaaccgaacacag |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38928968 |
ccaatcagctcaagcttcaccccatttgccaggcttcctctacacaagaaacagaggaacatgcactccacagtaataataacaaattaaccgaacacag |
38928869 |
T |
 |
| Q |
173 |
ctttattttctgttcaatatattttgttat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38928868 |
ttttattttctgttcaatatattttgttat |
38928839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 227 - 327
Target Start/End: Complemental strand, 38928839 - 38928739
Alignment:
| Q |
227 |
tcgtaaattataaacaatgaatttcactaatccaaccgtttgtaattgtttgtgattaggttttggagtgggagaaaagagacatggccaaggatggtac |
326 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38928839 |
tcgtaaattataaagaatgaatttcactaatccaaccgtttgtaattgtttgtgattaggttttggagtgggagaaaagagacatggccaaggatggtac |
38928740 |
T |
 |
| Q |
327 |
c |
327 |
Q |
| |
|
| |
|
|
| T |
38928739 |
c |
38928739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University