View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9066_low_6 (Length: 456)
Name: NF9066_low_6
Description: NF9066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9066_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 11 - 74
Target Start/End: Original strand, 23329747 - 23329809
Alignment:
| Q |
11 |
aagcaagagaatgggtcatgtttgcatatatttgtgattcataattcatatatattaaaatgtt |
74 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23329747 |
aagcaagagaatgg-tcatttttgcatatatttgtgattcataattcatatatattaaaatgtt |
23329809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University