View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9067_low_14 (Length: 357)
Name: NF9067_low_14
Description: NF9067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9067_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 120 - 234
Target Start/End: Original strand, 13732048 - 13732162
Alignment:
| Q |
120 |
aagagggtggcgcgttgaagtgacgcgcgtggggcgagtgggggaatggataattggtgttgtaaggtcatagtaagtgaactgactcttgtttcctgtt |
219 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13732048 |
aagagggtggcgcgttgaagggacgcgcgtggggcgagtgggggaatggataattggtgttgtaaggtcatagtaagtgaactgactcttgtttcctgtt |
13732147 |
T |
 |
| Q |
220 |
atttggttttaatta |
234 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
13732148 |
atttagttttaatta |
13732162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 271 - 340
Target Start/End: Original strand, 13732522 - 13732591
Alignment:
| Q |
271 |
ggatagaaaatgtaaacactttcaaaggtttcaattatgaacctaaaacatttgtcaaaacaaaattatg |
340 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13732522 |
ggatagaaaatgtaaacacttttaaaggtttcaattatcaacctaaaacatttgtcaaaacaaaattatg |
13732591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 13731926 - 13731981
Alignment:
| Q |
1 |
agaaatcagaatcggagttgagttcggtgaaggtggggggagatgatgacatggcg |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13731926 |
agaaatcagaatcggagttgagttcggtgaaggtggggggagatgatgacatggcg |
13731981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University