View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9067_low_17 (Length: 252)
Name: NF9067_low_17
Description: NF9067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9067_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 226
Target Start/End: Original strand, 7410262 - 7410469
Alignment:
| Q |
19 |
ctcttcatatctctttacattttaattgtaaaataaaactatatatcggcgagttatgcatattaaaagctgtaaaaataggtactaataattgtttatg |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7410262 |
ctcttcttatctctttacattttaattgtaaaataaaactatatatcggcgagttatgcatattaaaagctgtaaaaataggtactaataattgtttatg |
7410361 |
T |
 |
| Q |
119 |
cagaagaaactaattacgtctctctcatttgcacaactcacatgcaatttctacagctataggtgcagtaaagtgtcctgtgactggcattgtttatttt |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7410362 |
cagaagaaactaattatgtctctctcatttgcacaactcacatgcaatttctacagctataggtgcagtaaagtgtcctgtgactggctttgtttatttt |
7410461 |
T |
 |
| Q |
219 |
aggaccac |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
7410462 |
aggaccac |
7410469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University