View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9068_low_3 (Length: 397)
Name: NF9068_low_3
Description: NF9068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9068_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 14 - 375
Target Start/End: Original strand, 26685123 - 26685495
Alignment:
| Q |
14 |
ctgtgaaataagagcgccgacattgattgtgttgtttcgttgcacttacgttgggttcgttctgtctttgtcacgtgtgttgtggacttagatattttgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26685123 |
ctgtgaaataagagcgccgacattgattgtgttgtttcgttgcacttacgttgggttcgttctgtctttgtcacgtgtgttgtggacttagatattttgt |
26685222 |
T |
|
| Q |
114 |
tgctacagatgctactgttgttgttattgtgtgtactgtgtttattcagtgttggctttttggattgatgatatttttgtgacagtgacgtatgtgtgct |
213 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26685223 |
tgctacagatgctaatgttgttgttactgtgtgtactgtgtttattcagtgttggctttttggattgatgatatttttgtgagagtgacgtatgtgtgct |
26685322 |
T |
|
| Q |
214 |
ggtaatggtcaatttgactaatcaatatacttagaggttaagcaaaaattagatatccaataggaaactagtaatttgtaaatctgttc-ttcnnnnnnn |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26685323 |
ggtaatggtcaatttgactaatcaatatacttagaggttaagcaaaaattagatatccaataggaaactagtaatttgtaaatctgttcttttttcttaa |
26685422 |
T |
|
| Q |
313 |
nnnnaaatattgatatggac----------gggttgtttgttttatgtgaggatttttgtggggccaacttaa |
375 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26685423 |
aaaaaaatattgatatggaccaggatgattgggttgtttgttttatgtgaggatttttgtggggccaacttaa |
26685495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University