View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9069_high_5 (Length: 331)
Name: NF9069_high_5
Description: NF9069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9069_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 176 - 313
Target Start/End: Complemental strand, 276589 - 276452
Alignment:
| Q |
176 |
tgatcatggtattagtagtaatagtcattatcactacaacccccctattgcattcagacccatacaagaacaagggataagcatggggatgggaaggtta |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
276589 |
tgatcatggtattagtagtaatagtcattatcaccacaacccccctattgcattcagacccatacaagaacaagggataagcatggggatgggaaggtta |
276490 |
T |
 |
| Q |
276 |
tctccaatgaatatgaatatgatgacagatagtaatat |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
276489 |
tctccaatgaatatgaatatgatgacagataataatat |
276452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 11 - 134
Target Start/End: Complemental strand, 276742 - 276619
Alignment:
| Q |
11 |
cacagactcgcctttccaccacggtttgcagcagttaaagggtagggatacaatacaaagagtgagaagctcgcccaatttatctaatattacaaacacc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
276742 |
cacagactcgcctttccaccacggtttgcagcagttaaagggtagggatacaatacaaagagtgagaagctcgcccaatttatctaatattacaaacacc |
276643 |
T |
 |
| Q |
111 |
aacaataatagacaatcaccaccc |
134 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
276642 |
aacaataatagacaatcaccaccc |
276619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University