View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9069_low_15 (Length: 249)
Name: NF9069_low_15
Description: NF9069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9069_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 14 - 225
Target Start/End: Original strand, 10013878 - 10014089
Alignment:
| Q |
14 |
tatactcaacactaattataagtttcagttgagcaaaaagtccattttactttatatttaagagctgcttttatgaaactaatgctaagctctttcacta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10013878 |
tatactcaacactaattataagtttcagttgagcaaaaagtccattttactttatatttaagagctgcttttatgaaactaatgctaagctctttcacta |
10013977 |
T |
 |
| Q |
114 |
aaacaatgaatgatattggtattatcttatgaagttttggccacacactagttattggtgcatcactttctcccggattttcatacccttttctcaacat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10013978 |
aaacaatgaatgatattggtattatcttatgaagttttggccacacactagttattggtgcatcactttctcccggattttcatacccttttctcaacat |
10014077 |
T |
 |
| Q |
214 |
aaccataaattc |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
10014078 |
aaccataaattc |
10014089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 73 - 110
Target Start/End: Original strand, 10013483 - 10013520
Alignment:
| Q |
73 |
aagagctgcttttatgaaactaatgctaagctctttca |
110 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
10013483 |
aagagttgcctttatgaaactaatgctaagctctttca |
10013520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University