View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9069_low_16 (Length: 238)
Name: NF9069_low_16
Description: NF9069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9069_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 15 - 195
Target Start/End: Original strand, 37347336 - 37347516
Alignment:
| Q |
15 |
cagagattggtgatttagagactacaattcatttttattaaagtattttagcttttatatataccgaggttccataagccaatgcttgtttgttgccatt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37347336 |
cagagattggtgatttagagactacaatttatttttattaaagtattttagattttatatataccgaggttccataagccaatgcttgtttgttgccatt |
37347435 |
T |
|
| Q |
115 |
gatcaaaatatcccctgattgtcttgtgtttgaacctaatctccctgaaatacatataaaataatatcatattttaattgg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37347436 |
gatcaaaatatcccctgattgtcttgtgtttgaacctaatctccctgaaatagatataaaataatatcatattttaattgg |
37347516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 76 - 161
Target Start/End: Complemental strand, 37321440 - 37321355
Alignment:
| Q |
76 |
taccgaggttccataagccaatgcttgtttgttgccattgatcaaaatatcccctgattgtcttgtgtttgaacctaatctccctg |
161 |
Q |
| |
|
||||||||||||||||| | | ||||||||| |||||||||| ||| ||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
37321440 |
taccgaggttccataagaaagttcttgtttgtgaccattgatcagaatttcccctgtttgtcttgtgtttgagcctaatctccctg |
37321355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 76 - 164
Target Start/End: Complemental strand, 37330361 - 37330273
Alignment:
| Q |
76 |
taccgaggttccataagccaatgcttgtttgttgccattgatcaaaatatcccctgattgtcttgtgtttgaacctaatctccctgaaa |
164 |
Q |
| |
|
||||||||| ||||||| || | ||||||||| |||||||||| ||| |||||| ||||||||||||||| | |||||||||||||| |
|
|
| T |
37330361 |
taccgaggtcccataagacagttcttgtttgtgaccattgatcagaatttcccctatttgtcttgtgtttgagcttaatctccctgaaa |
37330273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 76 - 135
Target Start/End: Complemental strand, 37298006 - 37297947
Alignment:
| Q |
76 |
taccgaggttccataagccaatgcttgtttgttgccattgatcaaaatatcccctgattg |
135 |
Q |
| |
|
|||||| ||||||||||||| ||||||||| ||||||||||| | ||| | ||||||||| |
|
|
| T |
37298006 |
taccgatgttccataagccagtgcttgttttttgccattgattagaattttccctgattg |
37297947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University