View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9069_low_6 (Length: 365)
Name: NF9069_low_6
Description: NF9069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9069_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 19 - 345
Target Start/End: Original strand, 29696394 - 29696720
Alignment:
| Q |
19 |
aatcatatgtttacaaattgtgatttgaaaagattagcatctcacatcaatggtctgttggagaaataagtattttccttctgttttgtagttggatatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29696394 |
aatcatatgtttacaaattgtgatttgaaaagattagcatctcacatcaatggtctgttggagaaataagtattttccttctgttttgtagttggatatc |
29696493 |
T |
|
| Q |
119 |
aatatttcttctctagtcagatacacagaagtatagtttatggagataaaccacgaaataggtatgctttatttatattttaactctgtattcatggttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
29696494 |
aatatttcttctctagtcagatacacagaagtatagtttatggagataaaccacgaaataggtatgctttatttatattttaactctgcattcatagtaa |
29696593 |
T |
|
| Q |
219 |
taagtactgtaattttgattaatagtatatttcctttgcaggcttgacttgtttttgcctaaaaatagcgacggaccaaaaccagttgttgctttcatta |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29696594 |
taagtactgtaattttgattaatagtatatttcctttgcaggcttgacttgtttttgcctaaaaatagcgacgggccaaaaccagttgttgctttcatta |
29696693 |
T |
|
| Q |
319 |
ctggtggagcctggattattgggtatg |
345 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
29696694 |
ctggtggagcctggattattgggtatg |
29696720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University