View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9070_low_4 (Length: 377)
Name: NF9070_low_4
Description: NF9070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9070_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 18 - 283
Target Start/End: Original strand, 258807 - 259072
Alignment:
| Q |
18 |
cttggactccaaactttgaactttatttttatggtaatatcaatagctacagcaactgcagctattcatgggttcagtgaagcatttcataaatacaagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
258807 |
cttggactccaaactttgaactttatttttatggtaatatcaatagctacagcaactgcagccattcatgggttcagtgaagcatttcataaatacaagc |
258906 |
T |
 |
| Q |
118 |
catttaagtataaaatgtagcttaggttttttaggtaagcttttagcatgtagaagctctaaagttggaatgtttaatggtagattattgcattgtaaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
258907 |
catttaagtataaaatgtagcttaggttttttaggtaagcttttagcatgtagaagctctcaagttggaatgtttaatggtagattattgcattgtaaag |
259006 |
T |
 |
| Q |
218 |
gagaaggaaattttgcatttatttgttttatcttcttattcttgcactccccagtcttctgatttt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
259007 |
atgaaggaaattttgcatttatttgttttatcttcttattcttgcactccccagtcttctgatttt |
259072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 299 - 353
Target Start/End: Original strand, 259067 - 259121
Alignment:
| Q |
299 |
gattttcatccatcttgccatttatatgcatacacatcatagcaatattgagatt |
353 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
259067 |
gattttcatccatcttgccattcatatgcatacacatcatagcaatattgagatt |
259121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University