View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9070_low_7 (Length: 296)
Name: NF9070_low_7
Description: NF9070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9070_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 50 - 253
Target Start/End: Original strand, 8758437 - 8758649
Alignment:
| Q |
50 |
aaaccaaactccaagctattgtcagttcttaaaatagaaagtttagttcctatttaatttcatatccaggtatcccattccttgaaattgtcaaacatgt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||||||||| |||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
8758437 |
aaaccaaactccaagctattgtcagttcttaaaacaaaaagtttagttcctatttgatttcatagacgggtatcccattccttgaaattgtcaaacatgt |
8758536 |
T |
 |
| Q |
150 |
cact---------caaatttgaacacatactcttcttgataaattatcaatcacaatgagaaaataggaagcagcaccttgagtgaacatactaaaaggt |
240 |
Q |
| |
|
|| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |||||||| |||||| |
|
|
| T |
8758537 |
catttttattgttctaatttgaacacatactcttcttgataaattatcaatcacaatgagaaaataggaaccaacaccttgagttaacatacttaaaggt |
8758636 |
T |
 |
| Q |
241 |
ttcctagaattat |
253 |
Q |
| |
|
||||||||||||| |
|
|
| T |
8758637 |
ttcctagaattat |
8758649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University