View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9071_high_14 (Length: 245)
Name: NF9071_high_14
Description: NF9071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9071_high_14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 14 - 245
Target Start/End: Complemental strand, 42270751 - 42270520
Alignment:
| Q |
14 |
aatactcttcgaaaggattcaacagtgaggcttgaatggtttgatgcattggtgaaagatgtagaagaaactgatatatcttgatcctcacaagaagagg |
113 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42270751 |
aatactcttcgagaggattcaacagtgaggcttgaatggtttgatgcattggtgaaagatgtagaagaaactgatatatcttgatcctcacaagaagagg |
42270652 |
T |
 |
| Q |
114 |
aagaatttggattattcatttggttgttccatgcatgtttaacatcattccaattagaagaaagagaatttgcttgaagataccaccagtttaatggagt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42270651 |
aagaatttggattattcatttggttgttccatgcatgtttaacatcattccaattagaagaaagagaatttgcttgaagataccaccagtttaatggagt |
42270552 |
T |
 |
| Q |
214 |
agtagaggtagcaatagtgtttccaccacatt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42270551 |
agtagaggtagcaatagtgtttccaccacatt |
42270520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University