View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9071_high_15 (Length: 239)

Name: NF9071_high_15
Description: NF9071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9071_high_15
NF9071_high_15
[»] chr8 (1 HSPs)
chr8 (37-223)||(8846473-8846659)


Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 37 - 223
Target Start/End: Original strand, 8846473 - 8846659
Alignment:
37 agagtgttcctgatggagatgtcttatttttgaaggtgaattcaagcttttatattaataatctatttaatttttctttaacatttaatagttctttcaa 136  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8846473 agagtgttcctgatggagatgtcatatttttgaaggtgaattcaagcttttatattaataatctatttaatttttctttaacatttaatagttctttcaa 8846572  T
137 acgattcatcttttagtgaaactcattaactactcgaattcaatcagttagtcttatgtaggccatgttgaggggatcgcatatgat 223  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
8846573 acgattcatcttttagtgaaacacattaactactcgaattcaatcagttagtcttatgtaggctatgttgaggggatcgcatatgat 8846659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University