View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9071_low_35 (Length: 239)
Name: NF9071_low_35
Description: NF9071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9071_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 37 - 223
Target Start/End: Original strand, 8846473 - 8846659
Alignment:
| Q |
37 |
agagtgttcctgatggagatgtcttatttttgaaggtgaattcaagcttttatattaataatctatttaatttttctttaacatttaatagttctttcaa |
136 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8846473 |
agagtgttcctgatggagatgtcatatttttgaaggtgaattcaagcttttatattaataatctatttaatttttctttaacatttaatagttctttcaa |
8846572 |
T |
|
| Q |
137 |
acgattcatcttttagtgaaactcattaactactcgaattcaatcagttagtcttatgtaggccatgttgaggggatcgcatatgat |
223 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8846573 |
acgattcatcttttagtgaaacacattaactactcgaattcaatcagttagtcttatgtaggctatgttgaggggatcgcatatgat |
8846659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University