View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9071_low_41 (Length: 221)
Name: NF9071_low_41
Description: NF9071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9071_low_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 9 - 203
Target Start/End: Complemental strand, 38752880 - 38752686
Alignment:
| Q |
9 |
ctaataatcttccctttcctcttgtttaattcnnnnnnngtctataaagatggtgataaatgattatgattagcacaagagagccagaaacaaccaaaaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38752880 |
ctaataatcttccctttcctcttgtttaattctttttttgtctataaagatggtgataaatgattatgattagcacaagagagccagaaacaaccaaaaa |
38752781 |
T |
 |
| Q |
109 |
ttcttacggccatgatgactggttctggttctccttgtggagcctgcaaattcttgaggagaaaatgtgttagaggttgtgtttttgcaccttac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38752780 |
ttcttacggccatgatgactggttctggttctccttgtggagcctgcaaattcttgaggagaaaatgtgttagaggttgtatttttgcaccttac |
38752686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 131 - 202
Target Start/End: Original strand, 30903962 - 30904033
Alignment:
| Q |
131 |
ttctggttctccttgtggagcctgcaaattcttgaggagaaaatgtgttagaggttgtgtttttgcacctta |
202 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
30903962 |
ttctggttctccttgtggagcttgcaaatttttgagaagaaaatgtataagaggttgtgtttttgcacctta |
30904033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University