View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9072_low_45 (Length: 349)
Name: NF9072_low_45
Description: NF9072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9072_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 17 - 189
Target Start/End: Complemental strand, 43203416 - 43203244
Alignment:
| Q |
17 |
aaccaaaaacttttaaatatatggtccaaaacgaaagatgaatattattctcagtaactttttcgtgtatttgcatgcttaaaagaattgaagtctttgt |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43203416 |
aaccaaaaaattttaaatatatggtccaaaacgaaagatgaatattattctcagtaactttttcgtgtatttgcatgcttaaaagaattgaagtctttgt |
43203317 |
T |
 |
| Q |
117 |
acccaaaaaataatcgaagtctctgaaaaaattggttgacttttatttctcccgttttattggttttgcaagc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43203316 |
acccaaaaaataatcgaagtctctgaaaaaattggttgacttttatttctcccgttttattggttttgcaagc |
43203244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 262 - 332
Target Start/End: Complemental strand, 43203171 - 43203101
Alignment:
| Q |
262 |
gaatgaagaatgaaaatagaccaacatgatgagtgataggccaaaaatttgtaaaaaatcgctacaaattt |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43203171 |
gaatgaagaatgaaaatagaccaacatgatgagtgataggccaaaaatttgtaaaaaatcgctacaaattt |
43203101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University