View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9072_low_47 (Length: 328)
Name: NF9072_low_47
Description: NF9072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9072_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 8e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 1521991 - 1521884
Alignment:
| Q |
1 |
tttgttaatgatatttacatatgcatatccattttgtgtaccatatctaagataaacgtttgattttatatggtggtttacaatctacttgaggaaacct |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1521991 |
tttgtcaatgatatttacatatgcatatccattttgtgtaccatatctaagataaacgtttgattttatatggtggtttacaatctacttgaggaaacct |
1521892 |
T |
 |
| Q |
101 |
gaatttaa |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
1521891 |
gaatttaa |
1521884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University