View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9072_low_49 (Length: 298)
Name: NF9072_low_49
Description: NF9072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9072_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 173 - 283
Target Start/End: Original strand, 40820412 - 40820522
Alignment:
| Q |
173 |
aaaaaaggaaggaactggtggaagaagaaatagaatacattaaaaagatgtatgctgtgaatagagatgtaccttataagaggaatatgctgtgataatc |
272 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40820412 |
aaaaaaggaaggaattggtggaagaagaaatagaatacattaaaaagatgtatgctgtgaatagagatgtaccttataagaggaatatgctgtgataatc |
40820511 |
T |
 |
| Q |
273 |
atgtaccttat |
283 |
Q |
| |
|
||||||||||| |
|
|
| T |
40820512 |
atgtaccttat |
40820522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 25 - 122
Target Start/End: Original strand, 40820304 - 40820401
Alignment:
| Q |
25 |
gcagagatctcatgtttataagtcagagcaatcatccctttataggctgattttgtacgtttgaattagttcaacccaaattttaagaaatatgataa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40820304 |
gcagagatctcatgtttataagtcagagcaatcatccctttataggctgattttgtacgtttgaattagttcaacccaaattttaagaaatattataa |
40820401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University