View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9072_low_59 (Length: 235)
Name: NF9072_low_59
Description: NF9072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9072_low_59 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 224
Target Start/End: Original strand, 40809836 - 40810045
Alignment:
| Q |
15 |
agaaacttcaacggtggtgtattgtggatttacggtggaagcgacggcgccgatggaagcgacggcgaggaagaaaacagggtagagataactattagga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40809836 |
agaaacttcaacggtggtgtattgtggatttacggtggaagcgacggcaccgatggaagcaacggcgaggaagaaaacagggtagagataactattagga |
40809935 |
T |
|
| Q |
115 |
gcgaggaagagaacgacgtcgtttttggttaaaccgattttaattaaagagtgagcgagtttaattgtaagggattttaattgagcgaaggttagtgttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40809936 |
gcgaggaagagaacgacgtcgtttttggttaaaccgattttaattaaagagtgagcgagtttaattgtaagggattttaattgagcgaaggttagtgttt |
40810035 |
T |
|
| Q |
215 |
gagaataatc |
224 |
Q |
| |
|
||||| |||| |
|
|
| T |
40810036 |
gagaagaatc |
40810045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University