View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9072_low_65 (Length: 216)
Name: NF9072_low_65
Description: NF9072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9072_low_65 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 4330787 - 4330605
Alignment:
| Q |
20 |
acaagcttatttataggagcacgtaagtaactatctgagtaacaagctgattataactcaattgctagctgaatccatttctctaataaacacaaaacgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4330787 |
acaagcttatttataggagcacgtaagtaactatctgagtaacaagctgattataactcaattgctagctgaatccatttctctaataaacacaaaacgc |
4330688 |
T |
 |
| Q |
120 |
tataatttttacaatagaagtgcatggataacataacaaatcacattttgaataacaatatcctcaaccttaagggcacaggt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4330687 |
tataatttttacaatagaagtgcatggataacataacaaatcacattttgaataacaatatcctcaaccttaagggcacaggt |
4330605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 182
Target Start/End: Complemental strand, 4338863 - 4338829
Alignment:
| Q |
148 |
taacataacaaatcacattttgaataacaatatcc |
182 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
4338863 |
taacataacaaatcacatcttgaataacaatatcc |
4338829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University