View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9074_high_4 (Length: 418)
Name: NF9074_high_4
Description: NF9074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9074_high_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 2e-90; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 54 - 265
Target Start/End: Complemental strand, 35239481 - 35239267
Alignment:
| Q |
54 |
gagaagcaggctgctgctagtgctcctctttcagatgcag---ggcccaatccttttgtaggagagtggcaaggcaaatctgtttctttcatgcgatcca |
150 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35239481 |
gagaaggaggctgctgctagtgctcctctctcagatgcagcagggccgagtccttttgtaggagagtggcaaggcaaatctgtttctttcatgcgatcca |
35239382 |
T |
 |
| Q |
151 |
acgaccatcagacccatgaaacacaaaggacttgggatacctcaggtcttcaagaattgcctctcaagtttgttcaaggggatcaaagcgcaaggaattg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35239381 |
acgaccatcagacccatgaaacacaaaggacttgggatacctcaggtattcaaggtttgcctctcaagtttgttcaaggggatcaaagcgcaaggaattg |
35239282 |
T |
 |
| Q |
251 |
gaggagaaaggtact |
265 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
35239281 |
gtggagaaaggtact |
35239267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 266 - 418
Target Start/End: Complemental strand, 35239769 - 35239617
Alignment:
| Q |
266 |
acccatgttcccttgaattggacaccaaatggttgggtatgcgacttccatttcaacgtcggcgatcaccttgaattcaaattcatcattgtccaccagg |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35239769 |
acccatgttcccttgaattggacaccaaatggttgggtatgcgacttccatttcaacgccggcgatcaccttgaattcaaattcatcattgtccaccagg |
35239670 |
T |
 |
| Q |
366 |
atgacactttacactgggaatctggggacaacagagtattaaacttgcccaat |
418 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35239669 |
atggcactttacactgggaatctggggacaacagagtattaaacttgcccaat |
35239617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University